Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 1598-5504(Print)
ISSN : 2383-8272(Online)
Journal of Agriculture & Life Science Vol.55 No.2 pp.89-97
DOI : https://doi.org/10.14397/jals.2021.55.2.89

Isolation and Evaluation of Fungicides for Control of Alternaria alternata Causing Alternaria Leaf Spot Disease on Lettuce

Hee-Yeong Kim, Jong-Hwan Shin, Noh-Hyun Lee, Sa-Heon Kim, Kyoung-Su Kim*
Division of Bio-Resource Sciences, BioHerb Research Institute, and Interdisciplinary Program in Smart Agriculture, Kangwon National University, Chuncheon, 24341, Korea

These authors contributed equally to this work.


*Corresponding author: Kyoung Su Kim Tel: +82-33-250-6435 Fax: +82-33-241-1721 E-mail: kims@kangwon.ac.kr
September 17, 2020 ; March 29, 2021 ; April 5, 2021

Abstract


Lettuce (Lactuca sativa L.) is one of the most important dietary vegetable crop consumed fresh in salads, sandwiches, and ssam (a veggie wrap). Alternaria leaf spot caused by Alternaria alternata is a common and severe symptom on romaine lettuce causing serious yield losses, but no fungicides are available to manage Alternaria leaf spot on romaine lettuce in South Korea. Therefore, we investigated romaine lettuce fields in Gangwon province, collected romaine lettuce leaves with symptoms of Alternaria leaf spot, and isolated the causal agents. By the sequence analysis of 18S rRNA internal transcribed spacer (ITS) and RNA polymerase II subunit 2(RPB2), the causal fungus was identified as A. alternata. We examined the inhibitory effects of six fungicides (mancozeb, boscalid, benomyl, difenoconazole, azoxystrobin, and fludioxonil) on mycelial growth of A. alternata isolates. The most effective fungicide was fludioxonil with 98% mycelial growth inhibition at the concentration of 10 μg/ml for A. alternata isolates. Benomyl and mancozeb were relatively less effective compared to other fungicides with 12% and 7% mycelial growth inhibition for A. alternaria isolates at the concentration of 10 μg/ml, respectively.



상추 점무늬병을 일으키는 Alternaria alternata의 분리 및 살균제 효과 검정

김희영, 신종환, 이노현, 김사헌, 김경수*
강원대학교 농업생명과학대학 생물자원과학부 한방바이오연구소 스마트농업융합학과

초록


Alternaria alternata는 전세계적으로 상추(Lactuca sativa L.)에 점무늬병(Alternaria leaf spot)을 일으켜 작물의 수량을 감소시키고 품질을 저해하는 것으로 알려져 있다. 하지만 우리나라에서 상추 점무늬병에 대한 공식적인 보고가 없고 방제를 위한 약제도 등록되지 않았다. 본 실험에서는 강원도 지역의 로메인상추 재배지를 조사하고 점무늬병에 걸린 로메인상추로부터 병원균을 분리하였다. 18S rRNA internal transcribed spacer (ITS)와 RNA polymerase II subunit 2(RPB2)영역의 DNA 염기서열을 분석하여 분리한 병원균이 A. alternata임을 확인하였고, 로메인상추에 병원균을 재접종하여 해당 병원균이 점무늬병의 원인 병원균임을 확인하였다. A. alternata의 화학적 방제를 위해 mancozeb, boscalid, benomyl, difenoconazole, azoxystrobin, fludioxonil 성분의 살균제를 선발하여 항균효과를 확인하였다. 확인 결과 10 μg/ml의 농도에서 fludioxonil이 약 98%의 균사생장 억제효과를 보여주어 가장 높은 효과를 나타내었으며, difenoconazole, boscalid, azoxystrobin, benomyl, mancozeb가 10μg/ml 의 농도에서 각각 약 85%, 58%, 42%, 12%, 7% 순으로 균사생장 억제효과를 보여주었다. 본 연구는 국내에서 최초로 상추 점무늬병과 그 원인균을 보고한다.



    Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries(iPET)
    319088032SB030

    서론

    상추(Lactuca sativa L.)는 국화과(Asteraceae)에 속하는 한해 살이풀이며 무기질, 비타민, 철분의 함량이 풍부한 신선 채소류로 쌈, 샐러드, 샌드위치 등 다양한 형태의 요리에 이용되는 대표적인 웰빙 식품이다(Kim et al., 2016). 상추는 한국, 중국, 미국, 유럽 등에서 주로 생산되는데 크게 결구상추(L. sativa var. capitata), 로메인상추(L. sativa var. longifolia), 줄기상추(L. sativa L. var. asparagina), 잎상추(L. sativa var. crispa)로 분류된다(Ann, 2009). 상추의 최대 생산지인 중국은 줄기상추를 주로 생산하고 있으며, 미국에서는 2010년 기준으로 결구상추(58%), 로메인상추 (29%), 잎상추(13%) 순으로 상추를 생산하였다(Kim et al., 2016;Mou, 2011). 상추는 우리나라에서 잎상추(청치마, 청축면, 적축면, 적치마상추)가 주를 이루어 결구상추, 로메인상추 등이 생산되고 있는데, 웰빙에 대한 관심도가 증가함에 따라 상추의 재배면적과 생산량도 2016년에 3,387ha, 86, 128 톤에서 2018년에 3,773ha, 93, 543 톤으로 증가하고 있는 추세이다(Chang et al., 2020;KOSIS, 2019;Lim et al., 2016;Seo et al., 2009). 특히 최근에는 로메인상추가 대만으로 수출이 이루어지고 있어 상추 생산량이 더 욱 증가될 것으로 기대된다.

    전 세계적으로 보고되고 있는 상추 곰팡이 병으로는 Alternaria sp.에 의한 점무늬병(leaf spot), Bremia lactucae에 의한 노균병(downy mildew), Pythium ultimum 에 의한 모잘록병(damping-off), Rhizoctonia solani에 의한 밑둥썩음병(bottom rot), Sclerotinia sclerotiorum에 의한 균핵병 (Sclerotinia rot), Botrytis cinerea에 의한 잿빛곰팡이병(gray mold)등이 보고되고 있는데, 우리나라에는 밑둥썩음병, 균핵병, 잿빛곰팡이병 등이 상추의 주요 병원균으로 보고되고 있다(Halaši et al., 2008;Kim & Cho, 2002;Lynch et al., 1991;Nordskog et al., 2008;Park et al., 2005). 그 중 Alternaria 속에 속하는 균류는 상추 이외에도 배, 사과, 키위, 토마토 등 다양한 농작물의 잎, 줄기, 열매 등에 감염하는 식물 병원균으로, 점무늬병, 검은무 늬병, 줄기썩음병 등을 일으켜 전 세계적으로 많은 경제적 손실을 일으키고 있다(Agamy et al., 2013;Kwon et al., 2011;Yun & Yu, 1992). 이들 병원균은 작물에 병을 일으켜 수량을 감소시키 고 품질을 저하시키며, 또한 alternariol, alternariol monomethyl ether, altenuene, alterxoins I, II, III 등의 진균독소(mycotoxin) 을 생성하여 인축에 중독 현상을 일으키기도 한다(Lee & Yu, 1995;Ostry, 2008). 따라서 작물을 재배할 때 생물학적 방제, 화학 적 방제 등 적절한 방제 기술을 이용한 병원균의 방제가 필요하다.

    현재 우리나라 상추에는 테부코나졸 입제, 플루디옥소닐 액상수 화제, 베노밀 수화제 등 밑둥썩음병, 균핵병, 노균병, 흰가루병, 잿 빛곰팡이병 등을 방제하기 위한 약제는 등록되어 있지만, 아직까지 A. alternata에 의한 점무늬병은 공식 보고되어 있지 않고, 방제하 기 위한 약제도 등록되어 있지 않다(한국작물보호협회, www.koreacpa.org). 본 연구에서는 강원도 춘천, 양구 등지에서 최근 문제 시되는 로메인상추 점무늬병을 조사하여 점무늬병에 걸린 이병체 에서 A. alternata를 분리하였고, 해당 균주의 병원성검정을 통해 상추 점무늬병의 원인균임을 국내 최초로 확인하였다. 그리고 병원 균의 화학적 방제를 위해 작용기작이 서로 다른 다양한 살균제들을 선발하여 로메인상추 점무늬병에 대한 기내 약제 테스트를 수행하 였다. 본 연구의 실험결과는 로메인상추 점무늬병을 방제할 수 있 는 기초자료가 될 것으로 사료된다.

    재료 및 방법

    1. 병원균의 분리 및 형태적 특징 확인

    2019년 9월 강원도 춘천, 양구의 로메인상추 재배지에서 약 2,000개의 로메인상추를 조사하여 점무늬병에 걸린 이병체의 비율 을 확인하였다. 점무늬병에 걸린 로메인상추 이병체는 실온에서 1일간 말린 후, 5 mm 정도의 크기로 잎을 잘라 ampicillin (100 μg/ml)이 첨가된 PDA (potato dextrose agar)배지에 접종하였다. 접종 후 25℃ 배양기에서 3일간 배양하였고, 자라난 균의 단포자를 분리하여 PDA 배지에 접종한 뒤 실험에 사용하였다. 병원균의 장기간 보관을 위하여 PDA 배지에 병원균을 접종하여 25℃ 배양 기에서 10일간 배양하였고, 균사가 자란 배지에 멸균수를 첨가하 고 표면을 긁어 포자 현탁액을 얻어 내었고, 장기 보존을 위하여 25% glycerol로 포자 현탁액을 만들어 -70℃에 보관하였다. 분리 한 균의 형태적 특징을 확인하기 위해 potato dextrose agar (PDA)(39g MB cell potato dextrose agar)에서 4 mm 직경의 병원균 agar plug를 한가운데 접종하고 25℃, 광조건에서 7일간 배양하여 균총의 색깔을 육안으로 확인하고 포자의 모양, 크기, 형성을 광학현미경(Axio Imager.A2, Zeiss, Germany)을 이용하 여 확인하였다

    2. 염기서열 분석 및 분자생물학적 동정

    병원균의 분자생물학적 동정을 위하여 우선 PDA 배지에서 균 을 3일간 배양하였고, 균사 표면을 이쑤시개를 이용하여 약 10-20 mg 정도를 긁어내어 drilling method를 이용하여 DNA를 추출하 였다(Chi et al., 2009). 병원균의 동정은 18SrRNA와 RNA polymerase II second largest subunit (RPB2) 영역의 DNA 염기서열을 각각 ITS1 (5―'TCCGTAGGTGAACCTGCGG―3')와 ITS4 (5' ―TCCTCCGCTTATTGATATGC―3'), RPB2-5f (5'―GAYG AYMGWGATCAYTTYGG―3')와 RPB2-7cR (5'―CCCATR GCTTGYTTRCCCAT―3')프라이머를 이용하여 polymerase chain reaction (PCR) 증폭하였고(Raja et al., 2017), 서울대학교 농업생명과학공공기기원(NICEM, Korea)에 의뢰하여 DNA 염기 서열을 분석하였다. 확인된 DNA염기서열은 NCBI BLASTN (http://www.ncbi.nlm.nih.gov/)프로그램을 이용하여 분석하였다. 선발한 종들의 ITS와 RPB2 염기서열을 순서대로 결합하였고, MEGA 6.0 프로그램을 이용하여 neighbor-joining 방법으로 phylogenetic tree를 작성하였다 (Saitou & Nei, 1987).

    3. 병원성 검정

    A. alternata KL-1를 PDA 배지에서 25℃에서 3일간 배양하여 포자형성을 유도하였다. 배양한 균사체에 멸균 증류수를 5 ml을 넣 은 후 멸균된 1.5 ml microcentrifuge tube를 이용하여 표면을 긁어 내었고, 2ml microcentrifuge tube에 두 겹의 miracloth를 이용하여 균사체를 걸러내어 포자 현탁액을 얻어내었다. 얻어진 포자 현탁액 은 hemocytometer를 이용하여 10×104conidia/ml의 농도로 조절하 였다. 상추는 잎의 길이가 약 15~17 cm인 로메인상추와 13~16 cm 인 적축면상추 및 청축면상추 잎을 사용하였으며, 농도가 조절된 현탁액을 분무기를 이용하여 각각의 잎에 2 ml 씩 spray 접종하였고, 접종된 상추의 잎은 밀폐 용기에 습실 처리하여 4일 후 발병 여부를 확인하였다. 실험은 3회 반복하였으며, 각 실험에서는 상추의 종류별 로 3개의 잎을 사용하였다. 병징이 나타난 상추 잎에서 앞서 설명한 방법을 이용하여 병원균을 다시 분리하였고, 18S rRNA와 RPB2 영역의 염기서열을 분석하여 병원균을 재동정 하였다.

    4. 농약 종류에 따른 병원균 균사생장 억제효과 조사

    멸균한 PDA가 약 55℃가 되었을 때 50 ml conical tube에 25 ml씩 붓고, mancozeb, boscalid, benomyl, difenoconazole, azoxystrobin, fludioxonil 성분의 살균제를 각각 0.01, 1, 100 μg/ml 의 농도로 조절하여 첨가하여 90mm의 petri dish에 부어 살균제 배지를 만들었다. 이후 PDA 배지에서 3일간 배양된 A. alternata 균주들의(KL-1, KL-2, KL-3, KL-7, KL-8) 균총 선단부를 직경 5 mm의 코르크 보러로 잘라서 살균제 배지 가운데 접종하여 5일 간 25℃에서 배양하였다. 살균제 배지에서 배양된 균들의 균사 생 장율을 무처리 PDA 배지에서 배양한 균들의 균사 생장율과 비교 하여 균사생장 억제율을 측정하였다. 실험은 총 3반복으로 진행하 였으며 Duncan multiple range test를 이용하여 통계 분석하였다.

    균사생장 억제율(%) =

    JALS-55-2-89_EQ1.gif

    추가적으로 상추에 밑둥썩음병을 일으켜 문제가 문제가 되고 있 는 Rhizoctonia solani에 대해 A. alternata 분리균들에 억제효과가 높은 fludioxonil, difenoconazole, boscalid를 이용하여 균사생장 억제율을 측정하였다. R. solani AG-1 (KACC 40108)는 한국미생 물 보존센터(Korean Culture Center of Microorganisms, KCCM) 에서 분양받아 사용하였다. 멸균한 PDA에 boscalid, difenoconazole, fludioxonil 성분의 농약을 각각 0.01, 1, 100 μg/ml의 농도로 첨가하여 살균제 배지를 만들고, 25℃에서 2일간 PDA 배지에서 배양한 R. solani AG-1의 균총 선단부를 코르크 보러로 잘라 살균 제 배지 가운데 접종하여 25℃에서 2일간 배양하고 균사생장 억제 율을 위와 같은 방법으로 측정하였다.

    결과 및 고찰

    1. 점무늬병의 발생과 동정

    최근 로메인상추에서 문제시 되는 점무늬병의 발병 정도를 조사 하기 위하여 2019년도 9월에 강원도 춘천과 양구에서 약 2,000개 의 로메인상추에서 검은색의 점무늬 병징을 나타나는 이병체를 조 사하였다(Fig. 1A and Table 1). 그 결과 춘천은 약 20%, 양구는 약 16%의 로메인상추가 점무늬병에 감염되어 있는 것을 확인하였 다. 점무늬병에 걸린 잎에서부터 병원균들을 분리하여 18s rRNA ITS 염기서열을 분석하여 동정한 결과 분리한 12개의 병원균들이 모두 Alternaria에 속하는 병원균임을 확인하였다. 분리한 병원균 들을 PDA에서 7일간 배양한 결과 초기에는 회백색을 띠다가 이후 황갈색의 색을 띠었고(Fig. 1B), 형성된 분생포자를 현미경으로 관찰한 결과 횡경막이 1개에서 6개, 종경막이 0개에서 3개가 관찰 되었고, 난형 또는 곤봉 모양의 포자가 한 개 또는 여러 개가 연쇄 상으로 있는 것으로 관찰되었다(Fig. 1C and Fig. 1D). 분생포자 의 평균적인 길이는 23.6 μm(8.7~37.1 μm 의 범위), 폭은 10.8 μm(6.3~13.9 μm)였다. 이러한 균학적 특성은 A. alternaria의 균 학적 특성과 유사하였다(Jeong et al., 2008;Woudenberg et al., 2013). 또한 Woudenberg et al. (2013)Alternaria species 유 전자 염기서열 분석방법을 따라 병원균의 DNA를 추출하여 18S rRNA 및 RPB2 영역의 염기서열을 분석하여 동정한 결과, 분리된 병원균들이 A. alternata CBS 916.96와 99% 이상의 염기서열 상동성을 가지며 Alternaria section Alternata와 같은 계통군에 속하여 다른 종들과 구분되는 cluster를 형성한다는 것을 확인할 수 있었다(Fig. 2 and Table 2). 이러한 결과들을 종합하여 상추 점무늬병으로부터 분리된 병원균들이 A. alternata임을 확인하 였다.

    2. 병원성 검정

    분리한 병원균이 로메인상추에 점무늬병을 일으키는 원인균임 을 확인하기 위하여 분리한 A. alternata의 분생포자를 로메인상추 에 접종하여 병징을 확인하였다. 접종된 로메인상추에서 4일 후 검은색의 반점 형태의 병반들이 관찰되었다(Fig. 3A). 로메인상추 품종뿐만 아니라 잎상추에서도 병원성을 나타내는지 확인하기 위 하여 적축면상추과 청축면상추에 A. alternata의 분생포자를 접종 하여 4일 뒤 확인하자 모두 병반징이 형성되는 것을 확인할 수 있었다(Fig. 3B and Fig. 3C). 기존에 보고된 연구에서 Alternaria leaf spot을 일으킨 상추는 병반이 암갈색에서 검은색이였으며 처 음엔 반점형태로 병반이 나타나고 이후 원형 또는 불규칙한 형태의 병반으로 발달하였다(Guo et al., 2018;kim & Choi, 2020). 이러 한 병반들과 접종한 로메인상추에서 관찰된 병반들은 서로 유사하 였다. 또한 병징이 관찰된 상추로부터 병원균을 다시 분리하여 PDA 배지에 배양하여 형태적 특징과 ITSRPB2 유전자 염기서 열을 분석하여 확인해 본 결과, 분리된 병원균이 A. alternata KL-1과 동일한 병원균임을 확인할 수 있었다. 이러한 실험 결과를 통하여 A. alternata KL-1이 상추에 점무늬병을 일으키는 병원균 임을 확인하였다.

    3. 농약 성분에 따른 균사생장 억제효과

    국외의 논문을 참고하여(Ben-Noon et al., 2001;Koike et al., 2017;Mamgain et al., 2013)상추의 점무늬병이나 다른 Alternaria 종에 방제 효과가 알려진 6종의 살균제를 선발하였다 (Table 3). 선발된 살균제를 이용하여 배지를 제작하고 5개의 A. alternata 분리균들을 접종해(KL-1, KL-2, KL-3, KL-7, KL-8) 각 약제 별 균사생장 억제효과의 평균을 측정하였다. A. alternata 분리균들의 균사생장 억제효과는 병원균의 삼투압에 대한 신호전달을 저해한 다고 알려진 fludioxonil (Ko et al., 2020)이 0.01 μg/ml에서 약 6%, 10 μg/ml에서 약 98%로 가장 높은 억제율을 보였으며, β-tubulin의 형성을 억제한다 알려진 benomyl(Ko et al., 2020)은 0.01 μg/ml약 2%, 10 μg/ml에서 12%로 가장 낮은 억제율을 보였 다(Fig. 4 and Fig. 5).

    Fludioxonil 외에는 세포막의 에르고스테롤의 생합성 억제 (Hagan et al., 1991)에 관여한다고 알려진 difenoconazole이 0.01 μg/ml에서 2%, 10 μg/ml에서 약 85%로 억제율이 높았으며, 숙신 산 탈수소효소를 저해하는 살균제로 알려진(Veloukas et al., 2014) boscalid가 0.01 μg/ml에서 약 4%, 10 μg/ml에서 약 58% 로 세 번째로 억제 효과가 높았다(Fig. 5). 이외의 multi-site activity 살균제인(Gullino et al., 2010) mancozeb는 0.01 μg/ml에서 약 6%, 10 μg/ml에서 7%를 억제하였고, 미토콘드리아에 작용하 여 호흡을 저해하고 ATP 생성을 방해하여(Bartlett et al., 2002) 에너지 결핍을 초래한다고 보고되는 azoxystrobin은 0.01 μg/ml 에서 약 4%, 10 μg/ml에서 약 42%의 억제율로 50% 이하의 상대 적으로 낮은 억제효과를 나타내었다(Fig. 5).

    A. alternata에 대해 억제 효과가 높았던 fludioxonil, difenoconazole 및 boscalid의 R. solani에 대한 균사성장억제 효과를 검정 한 결과, fludioxonil이 0.01 μg/ml에서 약 25%의 억제를 나타내 었고, 1 ㎍/ml의 농도에서는 84%의 억제율을 보여주어 가장 억제 효과가 높았다(Fig. 6 and Fig. 7). Boscalid는 0.01 μg/ml에서 약 4%, 100 μg/ml에서 71%를, difenoconazole은 0.01μg/ml 약 27%, 100μg/ml에서 65%의 억제율을 나타냈다(Fig. 6 and Fig. 7). 따라서 fludioxonil, difenoconazole, boscalid 모두 50% 이상 의 억제율을 보여주어 상추 밑둥썩음병 방제에도 효과적으로 적용 가능할 것이라 예측된다.

    최근 안전한 농산물에 관한 관심이 높아지며 일본, 대만, 홍콩, 한국 등의 나라에서 수입 농산물에 농약 안전관리를 강화하여 허용 된 농약의 잔류 허용기준을 설정하고 그 외의 농약은 불검출 수준 으로 관리하는 PLS (Positive List System)을 시행하고 있다. 따라 서 위의 결과를 대만과 홍콩의 PLS 잔류 허용량(Standards for Pesticide Residue Limits in Foods, 2020)과 비교하였을 때 fludioxonil은 A. alternaria 분리균들과 R. solani AG-1에서 가장 효과가 좋았으나 잔류 허용기준이 모두 0.01 mg/kg으로 매우 낮은 편이며 difenoconazole은 대만은 1.0 mg/kg, 홍콩은 2.0 mg/kg, Boscalid은 대만은 4.0 mg/kg, 홍콩은 40.0 mg/kg로 설정되어 있다. 따라서 상추의 A. alternaria 분리균들과 R. solani AG-1에 서의 균사 억제율은 fludioxonil가 가장 높았으나 잔류 허용기준이 낮아 수출용으로 재배하는 상추에는 difenoconazole 또는 boscalid를 이용하여 두 병원균을 방제하는 것이 수출을 위한 전략적 인 방법이라 사료된다.

    감사의 글

    본 연구는 농림축산식품부 농림식품기술기획평가원 농식품수 출비지니스전략모델구축사업(과제번호: 319088032SB030)의 지 원에 의해 수행되었습니다.

    Figures

    JALS-55-2-89_F1.gif

    Alternaria leaf spot disease and morphological characteristics of A. alterrnata.

    (A) Symptoms of Alternaria leaf spot on a lettuce leaf collected from a romaine lettuce field in Gangwon province. (B) Colony pigmentation grown on PDA for 7 days. (C) Conidia in a chain of A. alternata. (D) Conidia of A. alternata. Bar = 50μm

    JALS-55-2-89_F2.gif

    Phylogenetics tree relationship between A. alternata KL-1 and other reference isolates obtained from NCBI based on 18s rRNA and RPB2 region sequences of Alternaria spp. Bar represents the predicted substitution per site 0.005.

    JALS-55-2-89_F3.gif

    Pathogenicity test of A. alternata KL-1 on different cultivars of lettuce. Photographs were taken after inoculation of conidial suspension 10×104 conidia/ml by spraying on lettuce leaves. A: romaine lettuce. B: Red lettuce. C: Green lettuce.

    JALS-55-2-89_F4.gif

    Effectiveness of fludioxonil and benomyl on mycelial growth inhibition of A. alternaria alternata KL-1. Mycelial agar plugs of A. alternata KL-1 were inoculated on fungicide-amended potato dextrose agar plates. Photos were taken after 4 days at 25℃.

    JALS-55-2-89_F5.gif

    Average inhibitory effects of fungicides on mycelial growth of A. alternata isolates (KL-1, KL-2, KL-3, KL-7, KL-8). Fungicide suspensions were added to autoclaved potato dextrose agar to a final concentration of 0.01, 0.1, 1, 10, 100 and 1,000 μg/mL. Colony diameters were measured after 4 days at 25℃. All experiments were performed in triplicate and repeated three times. Data were analyzed by Duncan's multiple range test using the SigmaStat statistical software package (SPSS Inc.) and the same letters denote no significant differences at p = 0.05.

    JALS-55-2-89_F6.gif

    Effectiveness of fungicides on mycelial growth inhibition of R. solani AG-1. Mycelial agar plugs of R. solani AG-1 were inoculated on fungicide-amended potato dextrose agar plates. Photos were taken after 2 days at 25℃.

    JALS-55-2-89_F7.gif

    Inhibitory effect of fungicides on mycelial growth of R. solani AG-1. Fungicide suspensions were added to autoclaved potato dextrose agar to a final concentration of 0.1, 1, 10, 100, and 1,000 μg/mL. Colony diameters were measured after 2 days at 25℃. All experiments were performed in triplicate and repeated three times. Data were analyzed by Duncan's multiple range test using the SigmaStat statistical software package (SPSS Inc.) and the same letters denote no significant differences at p = 0.05.

    Tables

    Isolated fungal strains from romaine lettuce leaves in Gangwon Province

    GenBank accession numbers used to analyze phylogenetic tree

    Fungicides used in this study

    References

    1. Agamy R , Alamri S , Moustafa MF and Hashem M. 2013. Management of tomato leaf spot caused by Alternaria tenuissima Wiltshire using salicylic acid and agrileen. Int. J. Agric. Biol. 15: 266-272.
    2. Ahn WS. 2009. The encyclopedia of Korean crop land-Race. Eupub, Seoul, Korea, p.171.
    3. Bartlett DW , Clough JM , Godwin JR , Hall AA , Hamer M and Parr-Dobrzanski B. 2002. The strobilurin fungicides. Pest Manage. Sci. 58: 649-662.
    4. Ben-Noon E , Shtienberg D , Shlevin E and Vintal H. 2001. Optimization of chemical suppression of Alternaria dauci, the causal agent of Alternaria leaf blight in carrots. Plant Dis. 85: 1149-1156.
    5. Chang MS , Kim JH , Lee JS , Park MH , Chang EH and Hong YP. 2020. Comparison of the shelf-life of commercial salad lettuces based on packaging types. Korean J. Food Preserv. 27: 255-260.
    6. Chi MH , Park SY and Lee YH. 2009. A quick and safe method for fungal DNA extraction. Plant Pathol J. 25: 108-111.
    7. Gullino ML , Tinivella F , Garibaldi A , Kemmitt GM , Bacci L and Sheppard B. 2010. Mancozeb: Past, present, and future. Plant Dis. 94: 1076-1087.
    8. Guo RT , Shi YX , Zhao Q and Li BJ. 2018. Identification of the pathogens causing leaf spot on lettuce. Acta Phytopathol. Sin. 48: 418-422.
    9. Hagan AK , Gilliam CH , Fare DC and Bowen K. 1991. Application rates and spray schedules of ergosterol-biosynthesis inhibitor fungicides for control of black spot of rose. Plant Dis. 75: 1143-1146.
    10. Halaši TJ , Halaši RJ , Pajkert AA and Sokolova-Đokić LR. 2008. Fungal diseases of some vegetables grown in greenhouse and garden. Zb Matice Srp Prir Nauk. 114: 123-134.
    11. Jeong IH , Kim GH , Lim MT , Hur JS , Shin JS and Koh YJ. 2008. Brown ring spot on leaves of kiwifruit caused by Alternaria alternata. Res. Plant Dis. 14: 68-70.
    12. Kim B and Choi YJ. 2020. Alternaria alternata causing leaf spot on Lactuca serriola in Korea. Plant Dis. 104: 2293.
    13. Kim MJ , Moon Y , Tou JC , Mou B and Waterland NL. 2016. Nutritional value, bioactive compounds and health benefits of lettuce (Lactuca sativa L.). J. Food Compost. Anal. 49: 19-34.
    14. Kim WG and Cho WD. 2002. Occurrence of Sclerotinia rot on composite vegetable crops and the causal Sclerotinia spp. Mycobiology 30: 41-46.
    15. Ko YM , Choi JY , Choi GJ and Kim HT. 2020. Evaluation of Fungicides for the Control of Macrophomina phaseolina Causing the Charcoal Rot of Soybean. Korean J. Pestic. Sci. 24: 82-90.
    16. Koike ST , Smith RF , Cahn MD and Pryor BM. 2017. Association of the carrot pathogen Alternaria dauci with new diseases, alternaria leaf speck, of lettuce and celery in California. Plant Health Prog. 18: 136-143.
    17. KOSIS(Korean Statistical Information Service).2019. Statistics on production of greenhouse vegetable and greenhouse facilities for vegetable. http://kosis.kr/statHtml/statHtml.do?orgId=114&tblId=DT_114018_004&conn_path=I2
    18. Kwon JH , Cheon MG , Kim J and Kwack YB. 2011. Black rot of kiwifruit caused by Alternaria alternata in Korea. Plant Pathol J. 27: 298-305.
    19. Lee HB and Yu SH. 1995. Distribution of mycotoxin-producing isolates in the genus Alternaria. Korean J. Plant Pathol. 11: 151-157.
    20. Lim YK , Lee EJ , Ha JY and Park JW. 2016. I am ssam: Learning benefits of the Korean wrap food. International Conference on Human-Computer Interaction, pp.513-518.
    21. Lynch JM , Lumsden RD , Atkey PT and Ousley MA. 1991. Prospects for control of Pythium damping-off of lettuce with Trichoderma, Gliocladium and Enterobacter spp. Biol. Fertil. Soils. 12: 95-99.
    22. Mamgain A , Roychowdhury R and Tah J. 2013. Alternaria pathogenicity and its strategic controls. Res. J. Biol. 1: 1-9.
    23. Mou B. 2011. Mutations in lettuce improvement. Int. J. Plant Genom. 2011: 1-7.
    24. Nordskog B , Nærstad R , Herrero ML , Sundheim L and Hermansen A. 2008. Fungal pathogens in norwegian lettuce fields. Acta Agric. Scand. Sect. B. 58: 230-235.
    25. Ostry V. 2008. Alternaria mycotoxins: An overview of chemical characterization, producers, toxicity, analysis and occurrence in foodstuffs. Wld. Mycotoxin J. 1: 175-188.
    26. Park JY , Kim HW , Kim HJ , Chun OJ , Jung SJ , Choi WB , Lee SW and Moon BJ. 2005. Cultivation conditions for mass production of an antagonistic bacterium Stenotrophomonas maltophilia BW-13. Res. Plant Dis. 11: 158-161.
    27. Raja HA , Miller AN , Pearce CJ and Oberlies NH. 2017. Fungal identification using molecular tools: A primer for the natural products research community. J. Nat. Prod. 80: 756-770.
    28. Saitou N and Nei M. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.
    29. Seo MW , Yang DS , Kays SJ , Lee GP and Park KW. 2009. Sesquiterpene lactones and bitterness in Korean leaf lettuce cultivars. Hort. Sci. 44: 246-249.
    30. Veloukas T , Kalogeropoulou P , Markoglou AN and Karaoglanidis GS. 2014. Fitness and competitive ability of Botrytis cinerea field isolates with dual resistance to SDHI and QoI fungicides, associated with several sdh B and the cyt b G143A mutations. Phytopathology 104: 347-356.
    31. Woudenberg JH , Groenewald J , Binder M and Crous P. 2013. Alternaria redefined. Stud. Mycol. 75: 171-212
    32. Yun HK and Yu SH. 1992. Use of host-specific toxins from Alternaria pathogens for determining disease susceptibility of crops-(1)-evaluation of apple cultivar susceptibility to Alternaria blotch. Korean J. Plant Pathol. 8: 185-189.
    오늘하루 팝업창 안보기 닫기